Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.

Search Within Results

181 – 195 of 1,323 results

181

MilliporeSigma™ Upstate™ Acetyl-Histone H3, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C from date of receipt
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	P68431
Includes	Acetyl-Histone H3 ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3Ac.
Antigen	Acetyl-Histone H3
Regulatory Status	RUO
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Acetyl-Histone H3 (rabbit polyclonal IgG). One vial containing 125μg of protein A purified antibody in 125μL of storage buffer containing 0.1M Tris-glycine, pH 7.4, 0.15M NaCl, 0.05% sodium azide. Normal Rabbit IgG. One vial containing 125μg of normal rabbit IgG in 125μL volume. Control Primers. One vial containing 75μL of 5μM of each primer specific for for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	The acetyl-histone H3 antibody is made against a peptide corresponding to amino acids 1-20 of Tetrahymena histone H3 ARTKQTAR[K]STGG[K]APRKQL(C) where [K] is acetylated)
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes acetyl-histone H3

182

Avian Influenza A H4N6 Hemagglutinin Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™

Antibody pair for Solid phase sandwich ELISA

Pricing & Availability

183

Promotions Available

BD Mouse TCR V β Screening Panel

Monoclonal antibodies for T-cell receptors recognition

Pricing & Availability

184

MilliporeSigma™ Upstate™ Acetyl-Histone H3 (Lys4), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Gene Accession No.	Q16695
Includes	This ChIPAb+ Acetyl-Histone H3 (Lys4) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Acetyl-Histone H3 (Lys4)
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g , H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Acetyl-Histone H3 (Lys4) (rabbit polyclonal). One vial containing 100μL of immunoaffinity purified rabbit polyclonal in storage buffer containing 0.05% sodium azide with 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	KLH-conjugated,synthetic peptide containing the sequence …RTAcKQ… in which AcK corresponds to acetyl lysine 4 of human histone H3.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Histone H3 acetylated on Lys4.

185

MilliporeSigma™ Upstate™ LEF1α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C for one year from date of shipment
Host Species	Mouse
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q9UJU2
Isotype	IgG1
Includes	This ChIPAb+ LEF1 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	LEF1α
Regulatory Status	RUO
Gene Symbols	LEF1, DKFZp586H0919, TCF1ALPHA, LEF-1, TCF1-alpha
Gene ID (Entrez)	NM_016269.2
Formulation	Anti-LEF1 (mouse IgG1). 1 vial containing 100mg of thiophilic and size exclusion chromatography purified mouse IgG1 in 100mL of phosphate buffered saline with sodium azide. The antibody is made against amino acid residues 1-85 of human LEF1 and can recognize human and mouse LEF1. It does not cross-react with TCF-3 or TCF-4. Normal Mouse IgG. One vial containing 125μg of normal mouse IgG in 125μL volume. ChIP primers c-myc. One vial containing 75mL of 5μM of each control primer specific for human c-myc promoter. FOR: CCC AAA AAA AGG CAC GGA A; REV: TAT TGG AAA TGC GGT CAT GC
Immunogen	The antibody is made against amino acid residues 1-85 of human LEF1.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes LEF1 (lymphoid enhancer-binding factor 1).

186

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)α
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

187

BD Mouse T Lymphocyte Subset Antibody Cocktail

Designed to identify major subsets of T lymphocytes by direct immunofluorescent staining with flow cytometric analysis

Pricing & Availability
Specifications

Regulatory Status	RUO
Content And Storage	Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze.
Purification Method	Affinity Purified
Host Species	Mouse

188

MilliporeSigma™ RIPAb+™ IGF2 mRNA-Binding Protein 3 RIP Validated Antibody and Primer Set

This RIPAb+ IGF2 mRNA-binding protein 3 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing & Availability

189

MilliporeSigma™ Upstate™ Acetyl-Histone H3 (Lys9) Serum, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C from date of receipt
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Serum
Gene Accession No.	Q66I33
Includes	This ChIPAb+ Acetyl-Histone H3 (Lys9) Serum -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Acetyl-Histone H3 (Lys9) Serum
Regulatory Status	RUO
Gene Symbols	H3F3A, H3F3B, H3F3
Gene ID (Entrez)	NM_003493
Formulation	Anti-Acetyl-Histone H3 (Lys9) (rabbit polyclonal serum). One vial containing 25μL of antiserum containing 0.05% sodium azide before the addition of glycerol to 30%. Normal Rabbit Serum. One vial containing 25μL antiserum containing 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM of each primer specific for for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	The acetyl-histone H3 (Lys9) antiserum is made against a peptide corresponding to amino acids 4-14 of yeast histone H3 acetylated on lysine 9.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Acetyl-Histone H3 (Lys9)

190

Zika Virus (SPH2015) NS1 Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™

Antibody pair for Solid phase sandwich ELISA

Pricing & Availability
Specifications

Antigen	Zika Virus (SPH2015) NS1
Regulatory Status	RUO
Content And Storage	Storage of components varies. See protocol for specific instructions.
Gene Alias	Zika NS1, ZIKV NS1, ZIKV-NS1
Target Species	Virus
Host Species	Mouse
Conjugate	HRP
Applications	ELISA
Product Type	Antibody Pairs
Classification	Monoclonal

191

MilliporeSigma™ Upstate™ SMRTα, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Electromobility Shift Assay,Immunocytochemistry,Immunohistochemistry,Immunoprecipitation,Western Blot
Form	Ascites
Gene Accession No.	Q9Y618
Isotype	IgG2a κ
Includes	The ChIPAb+ SMRT set includes the SMRT antibody, a negative control mouse ascites and qPCR primers which amplify a 299bp region of human IκBα promoter.
Antigen	SMRTα
Regulatory Status	RUO
Gene Symbols	NCOR2, CTG26, N-CoR2, SMAP270, SMRT, SMRTE, SMRTE-tau, TNRC14, TRAC, TRAC-1, TRAC1
Purification Method	Unpurified
Gene ID (Entrez)	NP_001070729.1
Formulation	Anti-SMRT (mouse monoclonal). One vial containing 50μL of unpurified mouse monoclonal ascites with 0.05% sodium azide. Negative Ascites (mouse). One vial containing 50μL of mouse ascites with 0.05% sodium azide. ChIP Primers, IκBα promoter. One vial containing 75μL of 5μM of each primer specific for human IĸBα promoter. FOR: GAC GAC CCC AAT TCA AAT CG; REV: TCA GGC TCG GGG AAT TTC C
Immunogen	Recombinant protein corresponding to human SMRT.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes SMRT.

192

Novus Biologicals™ ARNT/HIF-1 beta Antibody Pack

For Research applications

Pricing & Availability

193

MilliporeSigma™ Upstate™ REST, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q13127
Includes	This ChIPAb+ REST -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	REST
Regulatory Status	RUO
Gene Symbols	NRSF, XBR
Gene ID (Entrez)	NP_005603
Formulation	Anti-REST (Rabbit Polyclonal). One vial containing 100μL 1.0mg/mL purified rabbit polyclonal in buffer containing 0.014M phosphate buffer, pH 7.6, 0.175M NaCl, 0.07% sodium azide, and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, human Snap25. One vial containing 75μL of 5μM of each primer specific for human Snap25 promoter. FOR: AGA CTC CTT TGC AGA CAA TTT CCT; REV: CAA CAC AGA AGA TTT CCA CAA GTA GAC
Immunogen	The REST purified antibody is made against a GST fusion protein corresponding to amino acids 801-1097 of human REST.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes REST, MW 125kDa predicted, 200kDa observed.

194

MilliporeSigma™ RIPAb+™ CUGBP1 RIP Validated Antibody and Primer Set

This RIPAb+ CUGBP1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing & Availability

195

MilliporeSigma™ Upstate™ EZH2, clone AC22α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q15910
Isotype	IgG2a
Includes	EZH2, clone AC22, ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of EZH2.
Antigen	EZH2, clone AC22α
Regulatory Status	RUO
Gene Symbols	EZH2; KMT6
Gene ID (Entrez)	NP_004447.2
Formulation	EZH2, clone AC22 (mouse monoclonal IgG2a). One vial containing 50μg of protein G purified antibody in 50μL PBS containing 0.05% sodium azide. Normal Mouse IgG. Two vials, each containing 25μg purified mouse IgG in 25μL storage buffer containing 0.1% sodium azide. ChIP Primers MYT-1 promoter Region. One vial containing 75μL of 5μM of each primer specific for the promoter region of human MYT-1. FOR: ACA AAG GCA GAT ACC CAA CG; REV: GCA GTT TCA AAA AGC CAT CC
Immunogen	EZH2,clone AC22 purified antibody is made against a GST fusion protein corresponding to amino acids 353-451 of human EZH2.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes EZH2, MW: ∽85-100kDa.

Antibody Panels and Kits

Filtered Search Results

Narrow Results

Avian Influenza A H4N6 Hemagglutinin Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™ Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Zika Virus (SPH2015) NS1 Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™ Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Novus Biologicals™ ARNT/HIF-1 beta Antibody Pack Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Avian Influenza A H4N6 Hemagglutinin Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™

Zika Virus (SPH2015) NS1 Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™

Novus Biologicals™ ARNT/HIF-1 beta Antibody Pack