Antibody Panels and Kits

181 – 195 of 1,272 results

181

MilliporeSigma™ Upstate™ N-CoR, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Gene Accession No.	Q60974.
Includes	This ChIPAb+ N-CoR -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	N-CoR
Regulatory Status	RUO
Gene Symbols	Ncor1, Rxrip13
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_035438
Formulation	Anti-N-CoR (Rabbit Polyclonal). One vial containing 75μg of affinity purified polyclonal in buffer containing 0.1M Tris-glycine (pH 7.4) and 150mM NaCl with 0.05% sodium azide before the addition of 30% glycerol. Concentration: 0.7mg/mL. Normal Rabbit IgG One vial containing 125μg of Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, p21. One vial containing 75μL of each primer (5μM) specific for the human p21 (WAF1/CIP1/CDKN1A) promoter. FOR: CCC ACA GCA GAG GAG AAA GAA; REV: CTG GAA ATC TCT GCC CAG ACA
Immunogen	KLH-conjugated linear peptide corresponding to a region between amino acids 1510 and 1540 of the N-CoR protein.
Classification	Polyclonal
Primary or Secondary	Primary

182

Human B Lymphocyte Enrichment Set - DM, BD IMag-DM, Biotin, BD

Pricing & Availability

183

Novus Biologicals™ Pluripotent Stem Cell Transcription Factor Antibody Pack

For Research applications

Pricing & Availability
Specifications

Antigen	Pluripotent Stem Cell Transcription Factor
Content And Storage	Store at 4C. Do not freeze.
Target Species	Human,Mouse,Rat,Bovine,Chicken,Primate,Sheep
Host Species	Rabbit
Conjugate	Unconjugated
Applications	Western Blot,Flow Cytometry,Immunohistochemistry,Immunocytochemistry,Immunofluorescence,Immunoprecipitation
Classification	Polyclonal
Immunogen	NB100-58842: A synthetic peptide made to the mouse Nanog protein (within residues 1-50). [Swiss-Prot Q80Z64]. NB100-2379-A synthetic peptide made to an internal portion

184

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)α
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

185

Anti-Human Foxp3 Staining Set APC, eBioscience™

Antibody Staining Kit

Pricing & Availability

186

MilliporeSigma™ RIPAb+™ hnRNPA1 (M9 Region) RIP Validated Antibody and Primer Set

This RIPAb+ hnRNPA1 (M9 Region) -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing & Availability

187

MilliporeSigma™ Upstate™ Acetyl-Histone H3 (Lys9/18), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Serum
Gene Accession No.	Q16695
Includes	This ChIPAb+ Acetyl-Histone H3 (Lys9/18) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Acetyl-Histone H3 (Lys9/18)
Regulatory Status	RUO
Gene Symbols	H3F3A, MGC87783, H3.3A, MGC87782, H3F3, H3.3B, H3F3B
Purification Method	Unpurified
Gene ID (Entrez)	NM_003493
Formulation	Anti-Acetyl-Histone H3 (Lys9/18) (rabbit polyclonal). One vial containing 25μL of rabbit antiserum containing 0.05% sodium azide before the addition of glycerol to 30%. Normal Rabbit Serum. One vial containing 25μL of antiserum containing 0.05% sodium azide. Control Primers, human GAPDH promoter. One vial containing 75μL of 5μM of each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	KLH-conjugated synthetic peptide (..ARAcKSTGGKAPRAcKQL..) in which AcK corresponds to acetyl-lysine at residue 9 and 18 of human Histone H3.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Histone H3 acetylated on lysines 9 and 18.

188

BD Biotin Human NK Cell Enrichment Set - DM

Negative selection of Natural Killer (NK) cells from peripheral blood

Pricing & Availability

189

Zika Virus (SPH2015) NS1 Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™

Antibody pair for Solid phase sandwich ELISA

Pricing & Availability
Specifications

Antigen	Zika Virus (SPH2015) NS1
Regulatory Status	RUO
Content And Storage	Storage of components varies. See protocol for specific instructions.
Gene Alias	Zika NS1, ZIKV NS1, ZIKV-NS1
Target Species	Virus
Host Species	Mouse
Conjugate	HRP
Applications	ELISA
Product Type	Antibody Pairs
Classification	Monoclonal

190

BD Biotin Mouse CD4 T Lymphocyte Enrichment Set - DM

For negative selection of CD4 T lymphocytes from mouse spleen or lymph node

Pricing & Availability

191

BD IMag™ Monocyte Enrichment Set

Optimized for used with IMagnet, and contains sufficient reagents to label 10e9 peripheral blood mononuclear cells

Pricing & Availability

192

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys9), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C in undiluted aliquots for up to 12 months from date of receipt; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Western Blot
Form	Purified
Gene Accession No.	Q16695
Includes	Trimethyl-Histone H3 (Lys9) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K9Me3.
Antigen	Trimethyl-Histone H3 (Lys9)
Regulatory Status	RUO
Gene Symbols	H3F3A, MGC87783, H3.3A, MGC87782, H3F3, H3.3B, H3F3B
Gene ID (Entrez)	NP_003484
Formulation	Anti-trimethyl-Histone H3 (Lys9) (rabbit polyclonal IgG). One vial containing 100μg protein A purified IgG in 100μL of 0.02 M Phosphate buffer, pH 7.4, 0.25 M NaCl, 0.05% sodium azide with 30% glycerol. Normal Rabbit IgG. One vial containing 125μg of normal rabbit IgG in 125μL storage buffer containing 0.1% sodium azide. ChIP Primers, ZNF554. One vial containing 75μL of 5μM of each primer specific for ZNF554. FOR: CGG GGA AAA GCC CTA TAA AT; REV: TCC ACA TTC ACT GCA TTC GT
Immunogen	The trimethyl-histone H3 (Lys9) purified antibody is made against BSA-conjugated,synthetic peptide containing the sequence …AR[me3K]S… in which me3K corresponds to trimethyl lysine 9 of human Histone H3.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes histone H3, Mr 17kDa, trimethylated at lysine 9.

193

BD Biotin Mouse Dendritic Cell Enrichment Set - DM

For the negative selection of dendritic cells (DC) from mouse spleen or lymph node

Pricing & Availability

194

MilliporeSigma™ Upstate™ HDAC2α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q92769
Isotype	IgG1
Includes	This ChIPAb+ HDAC2 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	HDAC2α
Regulatory Status	RUO
Gene Symbols	HDAC2, HD2, YAF1, RPD3
Purification Method	Protein G purified
Gene ID (Entrez)	NP_001518
Formulation	Anti-HDAC2 (mouse monoclonal). One vial containing 50μg of purified mouse monoclonal IgG in buffer containing 70% storage buffer (0.1M Tris-glycine, pH 7.4, 0.15M NaCl, 0.05% sodium azide) and 30% glycerol. Concentration: 0.94mg/mL. Normal Mouse IgG. One vial containing 125μg of purified mouse IgG in 125μL of storage buffer containing 0.1% sodium azide. ChIP Primers, VWF promoter. One vial containing 75μL of 5μM of each primer specific for the promoter region of human von Willebrand factor. FOR: GCT GAG AGC ATG GCC TAG GGT GGT GGG CGG CAC; REV: CCC CTG CAA ATG AGG GCT GCG GCT ATC TCC AAG
Immunogen	KLH-conjugated,synthetic peptide (CEKTDTKGTKSEQLSNP) corresponding to human HDAC2 at the C-terminus.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	This antibody recognizes HDAC2 at the C-terminus.

195

MilliporeSigma™ Upstate™ LEF1α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing & Availability
Specifications

Content And Storage	−20°C for one year from date of shipment
Host Species	Mouse
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q9UJU2
Isotype	IgG1
Includes	This ChIPAb+ LEF1 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	LEF1α
Regulatory Status	RUO
Gene Symbols	LEF1, DKFZp586H0919, TCF1ALPHA, LEF-1, TCF1-alpha
Gene ID (Entrez)	NM_016269.2
Formulation	Anti-LEF1 (mouse IgG1). 1 vial containing 100mg of thiophilic and size exclusion chromatography purified mouse IgG1 in 100mL of phosphate buffered saline with sodium azide. The antibody is made against amino acid residues 1-85 of human LEF1 and can recognize human and mouse LEF1. It does not cross-react with TCF-3 or TCF-4. Normal Mouse IgG. One vial containing 125μg of normal mouse IgG in 125μL volume. ChIP primers c-myc. One vial containing 75mL of 5μM of each control primer specific for human c-myc promoter. FOR: CCC AAA AAA AGG CAC GGA A; REV: TAT TGG AAA TGC GGT CAT GC
Immunogen	The antibody is made against amino acid residues 1-85 of human LEF1.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes LEF1 (lymphoid enhancer-binding factor 1).

Welcome to fishersci.com

Antibody Panels and Kits

Filtered Search Results

Narrow Results

Novus Biologicals™ Pluripotent Stem Cell Transcription Factor Antibody Pack Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Zika Virus (SPH2015) NS1 Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™ Small and Specialty Supplier PartnerSmall and/or specialty supplier based on Federal laws and SBA requirements.Learn More

Novus Biologicals™ Pluripotent Stem Cell Transcription Factor Antibody Pack

Zika Virus (SPH2015) NS1 Mouse anti-Virus, HRP, Antibody Pair, Novus Biologicals™